[ Ana Sayfa | Editörler | Danışma Kurulu | Dergi Hakkında | İçindekiler | Arşiv | Yayın Arama | Yazarlara Bilgi | E-Posta ]
Fırat University Journal of Health Sciences (Veterinary)
2021, Cilt 35, Sayı 1, Sayfa(lar) 049-052
[ Özet ] [ PDF ] [ Benzer Makaleler ] [ Yazara E-Posta ] [ Editöre E-Posta ]
Coenurosis’li Sığırlarda Bazı Vitamin ve İz Element Düzeyleri
Abdullah GAZİOĞLU1, Meltem KIZIL2, Harun Kaya KESİK3, Ömer KIZIL4
1Bingöl Üniversitesi, Gıda Tarım ve Hayvancılık Meslek Yüksek Okulu, Bingöl, TÜRKİYE
2Fırat Üniversitesi, Veteriner Fakültesi, Fizyoloji Anabilim Dalı, Elazığ, TÜRKİYE
3Bingöl Üniversitesi, Veteriner Fakültesi, Parazitoloji Anabilim Dalı, Bingöl, TÜRKİYE
4Fırat Üniversitesi, Veteriner Fakültesi, İç Hastalıkları Anabilim Dalı, Elazığ, TÜRKİYE
Anahtar Kelimeler: Sığır, coenurosis, iz element, vitamin
Özet
Bu çalışmada, hastalığın yaygın olarak görülmediği sığır türünde saptanan Coenurus cerebralis vakalarında belirlenen bazı vitamin ve iz element düzeylerinin bildirilmesi amaçlanmıştır. Çalışma materyalini aralarında durgunluk, iştahsızlık, dengesiz yürüme, dönme hareketleri ve başlarını yukarı şekilde tutma şeklinde belirti gösteren 15 dananın olduğu bir çiftlikte bulunan 10 adet dana (hasta grubu) ile aynı işletmede bulunan ve herhangi bir hastalık belirtisi göstermeyen klinik olarak sağlıklı 10 adet dana (kontrol grubu) oluşturmuştur. Moleküler ve patolojik incelemeler sonucunda Coenurosis teşhisi konulan danalardan kan örnekleri alınarak serumları çıkarılmış ve bu danaların kan serumlarında vitamin A, vitamin E, bakır, kobalt, mangan ve çinko düzeyleri belirlenmiştir. Bu parametrelerden sadece vitamin E (P<0.05) ve bakır düzeyleri (P<0.05) bakımından gruplar arasında istatistiksel önem saptanırken, vitamin A, çinko, mangan ve kobalt düzeyleri bakımından ise herhangi bir istatistiksel önem bulunmamıştır (P>0.05).
  • Başa Dön
  • Özet
  • Giriş
  • Materyal ve Metot
  • Bulgular
  • Tartışma
  • Kaynaklar
  • Giriş
    Coenurosis, karnivorların ince bağırsaklarında yaşayan Taenia multiceps'in larva formu olan Coenurus cerebralis’in merkezi sinir sistemine yerleşerek neden olduğu bir hastalıktır. Karnivorların dışkıları ile atılan parazite ait yumurtaların ara konakçılar tarafından ağızdan alınması sonucunda çoğunlukla koyun, keçi ve sığırlarda, ayrıca nadiren deve, geyik, domuz ve atlarda görülen bir hastalıktır 1-4. Ara konakçılar tarafından yumurta ile bulaşık otların alınmasından sonra, embriyolar (onkosfer) bağırsak duvarından geçerek kan dolaşımı yoluyla beyine ulaşır. Kistlerin çoğu serebral hemisferlerde ve omurilikte bulunmakla beraber, deri altı ve kas içi dokularda da nadiren de olsa ortaya çıkabilirler 3. Kistlerin büyüklüğü ve yeri patogenezde önemli görünmektedir. Semptomlar dokularda ortaya çıkan kistin yerleşimine, büyüklüğüne ve beyne olan baskı derecesine göre değişiklik gösterir 3,5. C. cerebralis ilk dönemlerde prulent meningoensefalite neden olurken, daha sonra kist büyüdükçe genellikle ölümle sonuçlanan merkezi sinir sistemi semptomlarına yol açar. Karakteristik klinik bulguların çoğu etkenlerin alımından 2-8 ay sonra ortaya çıkmaktadır 1.

    Enfekte hayvanlarda klinik olarak dönme hareketleri, başın kistin yerleştiği tarafa doğru eğik tutulması, koordineli olmayan kontrolsüz hareketler, ataksi, başı dik tutamama, körlük, diş gıcırdatma, salivasyon, parezi, konvülsiyonlar, serebral atrofi, kafatasında incelme gibi morfolojik değişiklikler görülebilir 4,6. Klinik belirtiler hastalık şüphesini uyandırsa da, kesin tanı genellikle nekropside beyindeki kistlerin belirlenmesi ile olur 3. Bazı hayvanlar ise hiçbir belirti göstermeden yaşayabilirler ve hastalığın teşhisi ancak ölüm sonrası nekropsi ile olur. Bu nedenlerden dolayı hastalık özellikle koyun çiftliklerinde ciddi ekonomik kayıplara neden olabilir 7,8.

    C. cerebralis dünya genelinde koyun ve keçilerde ekonomik anlamda önemli bir sorun olmakla beraber 9, sığırlar arasında C. cerebralis vakalarına hem ülkemizde hem de dünyada daha az sıklıkla rastlanmaktadır 10,11. Türkiye’de yapılan bir çalışmada Erzurum ilinde sığırlardaki hastalık prevalansı %0.47 olarak bildirilmiştir 12.

    Bu çalışmanın amacı, hastalığın daha az sıklıkla görüldüğü sığırlarda saptanan C. cerebralis vakalarındaki bazı vitamin (vitamin A ve E) ve iz element (bakır, çinko, kobalt ve mangan) düzeylerini bildirmektir.

  • Başa Dön
  • Özet
  • Giriş
  • Materyal ve Metot
  • Bulgular
  • Tartışma
  • Kaynaklar
  • Materyal ve Metot
    Aralarında durgunluk, iştahsızlık, dengesiz yürüme, dönme hareketleri ve başlarını yukarı şekilde tutma şeklinde belirti gösteren danaların olduğu 60 başlık bir işletmede, işletme sahibi hastalık belirtilerini gösteren danalarının teşhis ve tedavisi amacıyla tarafımıza başvurmuş ve kendisinden “hasta sahibi onam belgesi” alındıktan sonra sürüsü muayene edilmiştir. Çalışmanın materyalini yukarıdaki gibi sinirsel belirtiler gösteren 10 adet dana (hasta grubu) ile aynı işletmede bulunan ve herhangi bir hastalık belirtisi göstermeyen klinik olarak sağlıklı 10 adet dana (kontrol grubu) oluşturmuştur. İşletme sahibi durumu kötü olan bir danası için teşhis amaçlı otopsi yapılmasına izin vermiştir. Ertesi günlerde ise durumu kötü olan ve kesime yollamaya karar verdiği üç danasının daha otopsi için kafaları ve kan örnekleri yine teşhis amacıyla alınmıştır. Nekropsi işleminde beyne zarar vermeden kafatası dikkatlice açılmıştır. Beyinin tam olarak ortaya çıkarmak için bir bisturi ile meninkslere kesiler yapılmış ve beyin dokusu C. cerebralis kistlerinin varlığı yönünden incelenmiştir.

    Örneklerin moleküler karakterizasyonu için beyin dokusundan kist materyali toplanmış ve işleninceye kadar %70 etanol içinde saklanmıştır. Genomik DNA izolasyonu aşamasında öncelikle protoskoleksler eppendorf tüplere konularak 5 kez PBS ile yıkanmış, son yıkamadan sonra tüplere 400 μL lysis buffer ve 20μL Proteinase-K (20 mg/mL) (Sigma, USA) konulup 1 gece 56 ºC’de bekletildikten sonra Fermentas Genomic DNA Purification Kit ile total genomik DNA izolasyonu kit protokolünde belirtildiği şekilde yapılmıştır. Moleküler analiz amacıyla mitokondrial sitokrom oksidaz 1 (cox1) gen bölgesi PZR ile çoğaltılmış, toplam 50 μL’lik hacimde hazırlanan PZR karışımına 5 μL 10X PZR buffer, 5 μL 25 mM MgCL2, deoksinükleotidlerin her birinden 250 μM, 1.25 U Taq DNA Polymeraz enzimi, primer çiftlerinin her birinden 20 pmol ve ortalama 200 ng template DNA ilave edilmiştir. PZR amplifikasyonunda 95 ºC’de 5 dk ön denatürasyon aşamasını takiben, toplam 35 PZR siklusu 94 ºC’de 50 sn denatürasyon, 45 ºC’de 50 sn hibridizasyon, 72 ºC’de 50 sn sentez olarak gerçekleştirilmiş ve son siklusu takiben 72 ºC’de 10 dk ekstra sentez işlemi yapılmıştır. Çalışmada cox1 genini çoğaltmak için JB3 (TTTTTTGGGCATCCTGAGGTTTAT) ve JB4.5 (TAAAGAAAGAACATAATGAAAATG) adlı primerler kullanılmıştır. PZR ile elde edilen ürünler, %1.4’lük agaroz jelde 10 μL PZR ürünü ile 5 μL yükleme solüsyonu karıştırılarak jeldeki kuyucuklara yüklenmiş ve TAE tampon solüsyonunda 90 voltta 45 dk süreyle yürütülmüştür. Daha sonra jel, ethidium bromide (10 mg/ml) ile 30 dk boyanıp, UV transilluminatörde bandların varlığı yönünden incelenmiştir. Bandların moleküler ağırlığını belirlemek için 100 bp’lik marker kullanılmıştır. PZR işleminde pozitif kontrol olarak daha önce sekans analiziyle teyid edilmiş ve laboratuvarımızda mevcut olan gDNA, negatif kontrol olarak da distile su kullanılmıştır 13.

    Moleküler ve patolojik incelemeler sonucunda Coenurosis teşhisi konulan dört adet dananın bulunduğu işletmeye tekrar gidilerek, sürüde hastalık semptomu gösteren 6 dana ile klinik olarak sağlıklı ve herhangi bir semptom göstermeyen 10 danadan daha tekniğine uygun olarak V. jugularis’ten antikoagulantlı kan örnekleri alınarak serumları çıkarılmış ve bu danaların kan serumlarında vitamin A, vitamin E, bakır, kobalt, mangan ve çinko düzeyleri belirlenmiştir.

    İz element düzeyleri atomik absorbsiyon cihazı kullanılarak (Perkin Elmer AAS 800, USA) ölçülmüştür. Bu analizde bakır için 324.8 nm, çinko için 213.9 nm, mangan için 279.5 nm ve kobalt için 240.7 nm dalga boylarında ölçümler yapılmış ve her örnek 3 defa çalışılarak ortalamaları alınmıştır 14.

    Vitamin A ve vitamin E analizinde HPLC cihazı (Shimadzu, DGU-20A5, Japan) kullanılmıştır. Bu işlemde 0.3 mL serum alınıp, 4 mL etil alkol (%1 H2SO4 içeren) de çözdürülerek proteinler parçalanmıştır. Daha sonra örnekler 4500 rpm de 25 dk santrifüj edilmiştir. Sonradan 0.3 mL hekzan eklenerek iyice vortekslenmiş ve bir daha santrifüj edilmiştir. Santrifüj sonrası hekzan karışımı dikkatlice cam tüpe alınmış, 0.3 mL hekzan eklenmiş ve tekrar santrifüj edilmiştir. Sonradan hekzan karışımı azot akışı altında buharlaştırılmış ve geriye kalan tortu 100 μL metanol ile çözdürülmüştür. Son olarak bu çözdürülen karışımdan 20 μL HPLC cihazına enjekte edilerek, vitamin A 326 nm’de, vitamin E ise 296 nm'de belirlenmiştir 15.

    Verilerin istatistiki analizi Statistical Package for the Social Science (SPSS for Windows: versiyon 22.0) paket programı kullanılarak gerçekleştirilmiştir. Değişkenlerin normal dağılıma uygunluğu analitik yöntemlerle (Kolmogorov-Smirnov / Shapiro-Wilk testleri) incelendi. Tanımlayıcı analizler normal dağılım gösteren değişkenler için ortalama ve standart hata şeklinde gösterildi. Elde edilen sonuçların istatistiksel analizinde, normallik testi sonucuna göre bütün bağımlı değişkenler normal dağılım gösterdiğinden, istatistiksel değerlendirmede parametrik bir yöntem olan bağımsız t-testi uygulanmıştır 16. P<0.05 ve altında olan durumlar istatistiksel olarak anlamlı değerlendirildi.

  • Başa Dön
  • Özet
  • Giriş
  • Materyal ve Metot
  • Bulgular
  • Tartışma
  • Kaynaklar
  • Bulgular
    Klinik olarak depresyon ve dönme hareketi belirtileri olan dananın otopsisinde ve ayrıca ertesi günlerde kesime yollanan danalardan alınan 3 adet kafatasının nekropsisinde, beyin parankim dokusunda C. cerebralis kistlerine rastlanmıştır. Uygulanan PCR işlemi sonucunda, mt-cox1 bölgesinde band veren (446 bp) örneklerin C. cerebralis olduğu tespit edilmiştir (Şekil 1).


    Büyütmek İçin Tıklayın
    Sekil 1: Coenurus cerebralis kistlerinin mt-CO1 PCR sonuçları. M: İşaretçi (100 bp), 1-4: dana örnekleri

    Çalışma ve kontrol grubu danalarda belirlenen vitamin A, vitamin E, bakır, çinko, mangan ve kobalt gibi iz element düzeylerinin ortalama değerleri, standart sapmaları ve bu değerlerin kontrol değerleriyle arasındaki istatistiksel farklılıklar Tablo 1’ de verilmiştir.


    Büyütmek İçin Tıklayın
    Tablo 1: Çalışma ve kontrol grubu danaların kan serumlarında saptanan vitamin A, vitamin E, bakır, çinko, mangan ve kobalt düzeylerinin ortalama değerleri, standart sapmaları ve istatistiksel önem dereceleri

    Tablo 1 incelendiğinde, sadece vitamin E (P<0.05) ve bakır düzeyleri (P<0.05) bakımından gruplar arasında istatistiksel önem olduğu, vitamin A, çinko, mangan ve kobalt düzeyleri bakımından ise herhangi bir istatistiksel önem saptanmadığı anlaşılmaktadır.

  • Başa Dön
  • Özet
  • Giriş
  • Materyal ve Metot
  • Bulgular
  • Tartışma
  • Kaynaklar
  • Tartışma
    Coenurosis, kesin konakçı olan köpek ve vahşi karnivorların ince bağırsaklarında yaşayan Taenia multiceps’in larva formu olan C. cerebralis’in neden olduğu, başlıca koyun gibi ruminantlar yanında atlar ve domuzlarda görülen bir merkezi sinir sistemi hastalığıdır 3,12,17,18. Sığırlarda hastalığa daha az rastlanmakla beraber bazen bireysel veya toplu vakalar şeklindeki hastalık olaylarına da rastlanabildiği bildirilmiştir 19-21.

    Mevcut çalışmanın anamnezinde, işletmede yaklaşık 1 aydan beridir çeşitli sinirsel semptomlar (dengesiz yürüme, başını bir yere dayama ve yukarı yönlü tutma, körlük, dönem hareketleri) gösteren danaların olduğu ve bu hastalara yapılan bazı tedavilere (antibiyotikler, antiparaziterler, vitamin B1, kalsiyum uygulamaları) cevap vermediği bilgisi elde edilmiş, sürüde yapılan klinik muayenelerde coenurosisten şüphelenilmiş ve işletme sahibinden onay alındıktan sonra genel durumu iyi olmayan bir dananın nekropsisine karar verilmiştir. İşletme sahibine daha önceden herhangi bir vitamin veya iz element takviyesi yapılıp yapılmadığı da sorulmuş, en son 2 ay önce bir AD3E vitamini uygulandığını ancak başka herhangi bir iz element solüsyonu veya ilacı uygulanmadığını beyan etmiştir. Bu bilgiden yola çıkılarak işletmeye sonradan tekrar gidilmiş ve işletme sahibinin onayı alındıktan sonra, kesimine karar verdiği 3 dana ile benzer klinik belirti gösteren 6 danadan, ayrıca klinik olarak sağlıklı ve herhangi bir semptom göstermeyen 10 danadan daha kan örnekleri alınmıştır. Toplam 20 adet danada (10 adet hasta grubu ve 10 adet kontrol grubu) vitamin A, vitamin E, bakır, çinko, mangan ve kobalt düzeyleri belirlenmiştir. Kafataslarının nekroskopik incelemesi ve alınan kist sıvısının PZR analizi sonucunda da danalardaki hastalık Coenurosis olarak teşhis edilmiştir.

    Coenurus’lu danalarda belirlenen vitamin A, vitamin E, bakır, çinko, mangan ve kobalt düzeyleri, aynı sürüde semptom göstermeyen diğer hayvanlarda belirlenen düzeylerle karşılaştırılmıştır. Bu değerlendirmenin gösterildiği Tablo 1 incelendiğinde sadece vitamin E ve çinko düzeyleri bakımından gruplar arasında istatistiksel önem saptandığı, diğer parametreler açısından ise bir önem olmadığı görülmektedir.

    A vitamini özellikle genç sığırlarda normal gelişim ve görüş için gereklidir. Eksikliğinde gece körlüğü ve epileptoid nöbetlere dahi rastlanabilmektedir 22. A vitamininin bu etkisinden hareketle, işletmedeki sürüde aynı zamanda A vitamini eksikliği olup olmadığı da araştırılmış, her ne kadar hastalardaki düzeyler kontrollere nazaran düşük saptanmış olsa da, istatistiksel bir anlam bulunamamıştır. E vitamini bilindiği üzere yağda çözünen en önemli antioksidanlardan bir tanesidir. Ayrıca hızlı gelişen hayvanlarda kas dejenerasyonları ile olan ilgileri de bilinmektedir 23-27. Çeşitli hastalık durumlarında organizmada artması muhtemel serbest radikallere karşı ilk savunmada vitamin E kullanılmakta ve düzeyleri azalmaktadır 23,24. Mevcut çalışmanın sonuçları incelendiğinde sağlıklı kontrollere nazaran E vitamini düzeylerinin Coenurosis’li danalarda düşük saptanmasının nedeni olarak, muhtemelen 1 aydan beri devam eden iştah azalması ve sinirsel semptomların yol açtığı stresin neden olduğu olumsuz etkilerin bertaraf edilmesi adına bu vitaminin fazlaca kullanılması düşünülmüştür.

    İz elementlerin özellikle gelişme çağındaki hayvanlardaki rolleri oldukça fazladır. Bu iz elementler vücutta birçok enzimin yapısına girerek organ ve sistem fonksiyonlarını güçlendirmektedirler. Özellikle iz element eksikliklerinde gelişme geriliği, kas iskelet yapısında anormallikler, sinirsel belirtiler, hastalıklara karşı mücadelede yetersizlikler ve üreme problemleriyle karşılaşılmaktadır. Bu nedenlerden dolayı da belirli düzeylerde alınmaları zorunludur 28,29. Mevcut çalışmada işletmedeki semptom gösteren danalarda genel olarak bir gelişme geriliği saptanmış olduğundan, bu hastalardaki iz element düzeylerinin de araştırılmasına karar verilmiştir. Analizler sonucunda ise sadece bakır düzeyi bakımından sağlıklı kontrollerle aralarında önem saptanmıştır. Bakır eksikliği ile özellikle besi işletmelerinde bir problem olarak karşılaşılabilir. Semptom olarak ise kilo kaybı, anemi, sinirsel belirtiler, kıllarda düzensizlikler, ishal ve bozulan immun sistem fonksiyonlarına neden olabilir 30. Ayrıca bakır vücudun en önemli antioksidan enzimi olan süperoksid dismutazın yapısına girmektedir 31. Yukarıda vitamin E için söylenen nedenlerden dolayı, özellikle hastalık belirtisi gösteren danalarda ortaya çıkması muhtemel oksidatif hasara yanıt olarak bakır elementinin de fazlaca kullanılmış olabileceği ve kontrollere nazaran düzeylerin düşük olmasının bu nedenden kaynaklanabileceği düşünülmüştür.

    Sonuç olarak her ne kadar hem vitamin A, hem de çinko, mangan ve kobalt düzeyleri bakımından gruplar arasında istatistiksel önem saptanmamış olsa da, düzeyler incelendiğinde hastalardaki değerlerin sağlıklı kontrollere nazaran daha düşük olduğu anlaşılmaktadır. Bu düzey düşüklüklerinin nedeni olarak ta, hastalık esnasında gelişen iştah ve yemden yararlanmanın azalması yanında bu maddelere olan ihtiyaçların artmasının da bir faktör olarak etkidiği düşünülmüştür. Yapılan literatür taramalarında Coenurosis’li danalarda vitamin ve iz element düzeyleriyle alakalı herhangi bir bildirime rastlanmamış olduğundan, bu çalışmadan elde edilen sonuçların araştırıcılar için farklı bir kaynak oluşturacağı sonucuna varılmıştır.

  • Başa Dön
  • Özet
  • Giriş
  • Materyal ve Metot
  • Bulgular
  • Tartışma
  • Kaynaklar
  • Kaynaklar

    1) Christodoulopoulos G. Two rare clinical manifestations of coenurosis in sheep. Vet Parasitol 2007; 143: 368-370.

    2) Güçlü F, Uslu U, Özdemir Ö. Bilateral bone perforation caused by Coenurus cerebralis in a sheep: Case report. T Parazitol Derg 2006; 30: 282-284.

    3) Sharma DK, Chauhan PPS. Coenurosis status in Afro-Asian region: A review. Small Rumin Res 2006; 64: 197-202.

    4) Yoshino T, Momotani E. A case of bovine boenurosis (Coenurus cerebralis) in Japan. Jpn J Vet Sci 1988; 50: 433-438.

    5) Gül Y, İssi M, Özer S. Clinical and pathological observations of flock of sheep showing epileptoid spasm related to Oestrosis and Coenurosis. FÜ Sağlık Bil Derg 2007; 21: 173-177.

    6) Akkaya H, Vuruşaner C. İstanbul’da kesilen koyunlarda ve danalarda Coenurus cerebralis. T Parazitol Derg 1998; 22: 320-324.

    7) Özmen O, Sahinduran S, Haligur M, Sezer K. Clinicopathologic observations on Coenurus cerebralis in naturally infected sheep. Scweiz Arch Tierheilk 2006; 147: 129-134.

    8) Scott PR. Diagnosis and treatment of coenurosis in sheep. Vet Parasitol 2012; 189: 75-78.

    9) Uslu U, Güçlü F. Prevalence of Coenurus cerebralis in sheep in Turkey. Medycyna Wet 2007; 63: 678-680.

    10) Yılmaz K, Can R. A case of coenurosis (Coenurus cerebralis Batsch, 1786) in a heifer. Ankara Univ Vet Fak Derg 1986; 33: 187-192.

    11) Gokce E, Beytut E, Tasci GT, et al. An outbreak of coenurosis in a cattle farm. Kafkas Univ Vet Fak Derg 2013; 19: A199-A202.

    12) Avcioglu H, Yıldırım A, Duzlu O, et al. Prevalence and molecular characterization of bovine coenurosis from Eastern Anatolian region of Turkey. Vet Parasitol 2011; 176: 59-64.

    13) Bowles J, Blair D, McManus DP. Genetic variants within the genus Echinococcus identified by mitochondrial DNA sequencing. Mol Biochem Parasitol 1992; 54: 165-173.

    14) Perkin-Elmer Corporation, Analytical Methods for Atomic Absorbtion Spectroscopy, 1996.

    15) Alayunt N, Çelik S, Koparır M, Karatepe M. The Effects Of 5,5'-Butane-1,4-Diylbis [4-Allyl-2- ({4-[3- (Trifluoromethyl) Phenyl] Piperazin-1-Yl} Methyl)- 2,4- Dihydro- 3h- 1,2,4-Triazole-3-Thione] Compound on mda level and vitamins in serum, liver and kidney of rats. New W Sci Acad - Physical Sci 2015; 10: 14-20.

    16) IBM SPSS, IBM Corp. Released 2013. IBM SPSS Statistics for Windows, Version 22.0. Armonk, NY, USA.

    17) Desouky EA, Badawy AI, Refaat RA. Survey on coenurosis in sheep and goats in Egypt. Vet Ital 2011; 47: 333-340.

    18) Varcasia A, Tosciri G, Coccone GN, et al. Preliminary field trial of a vaccine against coenurosis caused by Taenia multiceps. Vet Parasitol 2009; 162: 285-289.

    19) Giadinis ND, Brellou G, Pourliotis K, et al. Coenurosis in a beef cattle herd in Grece. Vet Rec 2007; 161: 697-698.

    20) The prevalence of Coenurus cerebralis in calves and sheep slaughtered in Istanbul. Türkiye Parazitol Derg 1998; 22: 320-324.

    21) Özkan C, Yıldırım S, Kaya A. Clinical coenurosis (Coenurus cerebralis) and associated pathological findings in a calf. Pak Vet J 2011; 31: 263-266.

    22) Gül Y, İssi M. Beta Karoten ve A vitamini yetmezliği (Hipovitaminozis A). Türkiye Klinikleri J Vet Sci Intern Med-Special Topics 2016; 2: 42-50.

    23) Buettner GR. The pecking order of free radicals and antioxidants: lipid peroxidation, alphatocopherol, and ascorbate. Arch Biochem Biophys 1993; 300: 535-543.

    24) Brigelius-Flohé R, Traber MG. Vitamin E: Function and metabolism. FASEB J 1999; 13: 1145-1155.

    25) Tafazoli S, Wright JS, O’Brien PJ. Prooxidant and antioxidant activity of vitamin E analogues and troglitazone. Chem Res Toxicol 2005; 18: 1567-1574.

    26) Ouahchi K, Arita M, Kayden H, et al. Ataxia with isolated vitamin E deficiency is caused by mutations in the alpha-tocopherol transfer protein. Nature Gen 1995; 9: 141-145.

    27) İssi M, Gül Y, Polat PF. Selenyum ve vitamin E yetmezliği. Türkiye Klinikleri J Vet Sci Intern Med-Special Topics 2016; 2: 25-31.

    28) McDowell LR. Minerals in animals and human nutrition. Academic Press, New York, 1992.

    29) Eren V, Atay O, Özdal GÖ. Organik bakır ve çinkonun toklularda canlı ağırlık ile bu minerallerin serum ve yapağıdaki düzeyleri üzerine etkisi. Kafkas Univ Vet Fak Derg 2011; 17: 95-99.

    30) Kozat S. Geviş getiren hayvanlarda iz elementlerin önemi, gerekliliği ve noksanlıklarının etkisi. YYU Sağlık Bil Derg 2006; 9: 58-67.

    31) Wong PC, Waggoner D, Subramaniam JR, et all. Copper chaperone for superoxide dismutase is essential to activate mammalian Cu/Zn superoxide dismutase. Proc Natl Acad Sci 2000; 97: 2886-2891.

  • Başa Dön
  • Özet
  • Giriş
  • Materyal ve Metot
  • Bulgular
  • Tartışma
  • Kaynaklar
  • [ Başa Dön ] [ Özet ] [ PDF ] [ Benzer Makaleler ] [ Yazara E-Posta ] [ Editöre E-Posta ]
    [ Ana Sayfa | Editörler | Danışma Kurulu | Dergi Hakkında | İçindekiler | Arşiv | Yayın Arama | Yazarlara Bilgi | E-Posta ]