A three-year-old, neutered, mixed-breed male cat presented to the clinic with anuria lasting 24 hours and dysuria, anorexia, and vomiting lasting approximately six months. According to the medical history, the cat had been taken to the veterinary clinic at regular intervals and prescribed antibiotics upon examination. It was also determined that the cat had lost 2 kilograms of weight due to its current health issues.
During the clinical examination of the cat, a high fever (39.6°C), dehydration, cachexia, stranguria, and hematuria were detected. The ultrasound examination revealed crystals in the bladder (Figure 1), a thickened bladder wall, and a dilated renal pelvis (Figure 2).
The serum biochemistry and hematology results indicated leukocytosis (31.94 X 109/L; reference range: 3.7–20.5 X 109/L), neutrophilia (27.16 X 109/L; reference range: 1.3–15.7 X 109/L), uremia (84.2 mg/dl; reference range: 20–65 mg/dL), hyperglycemia (159 mg/dl; reference range: 55-125 mg/dL), and a high serum creatinine level (2.28 mg/dl; reference range: 0.4-2 mg/dL). The remaining parameters were within the normal range.
The urethrostomy performed revealed a urethral stone blocking urine flow. The urinary stone was washed with 1 ml of sterile physiological saline in the direction of the bladder using a sterile urinary catheter and then transferred to the urinary bladder. By promoting urine output, approximately 150 ml of urine was drained. Microscopic examination revealed numerous erythrocytes and struvite crystals (SCs). The biochemical urine examination indicated leukocyturia (70 leukocytes/μL; reference range: 0-15 leukocytes/μL) and hematuria (200 erythrocytes/μL; reference range: 0-10 erythrocytes/μL).
The urine sample obtained by urethrocytomy was sent to the laboratory for bacteriological examination. It was observed that the owner of the animal had wounds on her hands and nails. We learned that she is a manicurist. It was also learned that the cat lived at home and had no contact with any person or animal other than the owner. Because the owner did not give permission, samples could not be taken from her wounds.
Ten microlitres of urine were distributed onto blood agar (Oxoid, UK) containing 5% sheep blood and MacConkey agar (Condalab, Spain) plates. The plates were incubated at 37°C in an aerobic atmosphere. Following a 24-hour incubation period, β-haemolytic pure colonies were observed and assessed for catalase activity. Further analysis of the isolate via tube coagulase testing showed it was a coagulase-positive staphylococci14. Identification of the isolate as S. pseudintermedius was conducted using matrix-assisted laser desorption ionisation time-of-flight mass spectrometry (MALDI-TOF MS, Bruker Biotyper 3.0, Microflex LT: Bruker Daltonics GmbH, Bremen, Germany). DNA isolation was conducted using a commercial extraction kit, following the protocol provided by the manufacturer (Vivantis, Malaysia). To confirm the molecular identification of the isolate, the 16S rRNA gene region was amplified using the universal 27F and 1492R primers. The resulting bidirectional DNA sequence analysis (ABI 3730XL, Applied Biosystems, Foster City, CA) confirmed that the isolate was S. pseudintermedius (accession number PP506266). The bacterial concentration in the urine was found to be high, at 3x104 CFU/mL.
Using the Kirby-Bauer disk diffusion method on Mueller-Hinton agar (Merck), the antimicrobial resistance of S. pseudintermedius against the following 16 agents representing nine different classes was investigated: penicillin G (10 IU), ampicillin (10 μg) amoxicillin-clavulanic acid (20/10 μg), ceftiofur (30 μg), cefoxitin (30 μg), oxacillin (1 μg), gentamicin (10 μg), erythromycin (15 μg), tetracycline (30 μg), enrofloxacin (5 μg), ciprofloxacin (5 μg), clindamycin (2 μg), rifampin (5 μg), sulfamethoxazole/trimethoprim (SM/TM, 23.75/1.25 μg), chloramphenicol (30 μg), and florfenicol (30 μg). The results were interpreted according to the M100 and VET01 (2023) criteria of the Clinical and Laboratory Standards Institute (CLSI)15. The isolate was resistant to all drug classes except the phenicol group antibiotics (chloramphenicol and florfenicol) and was categorized as XDR, as described by Magiorakos et al.16. The presence of mecA gene was determined by polymerase chain reaction assay using specific primers (Forward: ACTGCTATCCACCCTCAAAC; Reverse: CTGGTGAAGTTGTAATCTGG) according to the protocol reported by Özdemir and Keyvan17.
The treatment involved administering a total of 200 mL of balanced electrolyte solution at a rate of 5 mL/kg/hour daily, 1 mg/kg of furosemide (Lasix, Sanofi Aventis) twice a day, and ceftriaxone (Lesef, Ibrahim Etem) at a dose of 20 mg/kg intravenously twice a day. As part of the treatment, the bladder was washed using 50 mL of isotonic 0.9% NaCl. The diet was modified by applying Hill's Prescription Diet™ s/d™. A kidney supplement product (Ipakitine®) was administered to provide renal support. Based on the results of the antimicrobial susceptibility test (AST), the antibiotic was replaced with florfenicol (Flortek, Teknovet) administered at a dose of 20 mg/kg for seven days. After the treatment, the blood biochemistry level decreased to normal limits, clinical disease findings disappeared, and bacteriological recovery was achieved. Informed consent obtained from owner.
)
)
