Kısmi 16S rRNA Sekans Analizi Kullanılarak Kafesteki Kuşların Kloakal Örneklerindeki Bazı Potansiyel Patojen Bakterilerin Tanımlanması
Volume 37, Issue 2
June 2023 · Pages 146-150
Kısmi 16S rRNA Sekans Analizi Kullanılarak Kafesteki Kuşların Kloakal Örneklerindeki Bazı Potansiyel Patojen Bakterilerin Tanımlanması
Identification of Some Potentially Pathogenic Bacteria in Cloacal Swap Samples of Caged Birds Using Partial 16S rRNA Sequence Analysis
Rahem KHOSHBAKHT1
Kafes kuşları, bağırsak mikrobiyotalarında insane sağlığını tehdit edebilecek çeşitli mikroorganizmaları taşıyabilmektedirler. İnsanların yabani kafes kuşlarını besleme konusundaki ilgileri ve yabani kafes kuşlarının bakterileri insanlara bulaştırma potansiyelleri gözönüne alındığında, bu çalışma kafes kuşlarının bağırsak florasındaki bazı bakyeriyel etkenlerin polimeraz zincir reaksiyonu (PCR) ve sekans analizi ile belirlemek için yapılmıştır. İran'ın Mazandaran eyaletinin farklı bölgelerinden steril svap ile toplam 68 farklı kuş örneği toplandı ve kısmi 16SrRNA PCR ürününün sekanslanmasıyla bakteriyel etkenler identifiye edildi. Toplamda 11 numune, evrensel primerlerin kullanıldığı PCR ile pozitif bulundu PCR ürünleri, NCBI'den sekans erişim numaraları alınarak sekanslandı. Dizilerin diğer benzer dizilerle karşılaştırılması sonucunda dizilerin Corynebacterium, Tessaracoccus ve Christensenella türleri ile benzerlik gösterdiği belirlendi. Sonuçlar, bazı fırsatçı patojen bakterilerin insanlara bluşmasında kafes kuşlarının rol oynayabileceğini gösterdi.
Caged birds can be reservoirs of various microorganisms in their gut microbiota some of which can be harmful to humans. Considering people's interests in keeping wild cage birds and the potential ability of wild cage birds to transmit bacteria to humans, the present study was conducted to investigate some bacterial agents in the microflora of caged birds by polymerase chain reaction (PCR) and sequence analysis. Altogether 68 samples from different birds were collected with sterile cotton swabs from different areas of Mazandaran province, Iran and evaluated for detection of bacteria by sequencing of partial 16SrRNA PCR product. In total, 11 samples were positive for PCR reaction using universal primers. PCR products of samples were sequenced and results were uploaded to NCBI with the accession numbers. Comparison of the sequences with other similar sequences showed the similarity of the sequences to Corynebacterium, Tessaracoccus and, Christensenella species. Results showed the possible role of caged birds in the circulation and transmission of some opportunistic pathogenic bacteria.
Introduction
The gastrointestinal microbiota of animals plays an important role in health, immune response, and defense against pathogens. This microbiota varies depending on the host and diet of animals and humans [1]. Different microorganisms including microflora and other opportunistic transient pathogen bacteria live in the gastrointestinal tract of birds [2]. The higher body temperature of the birds in comparison with other animals such as ruminants or human microflora makes their microbiota specific and unique. Various bacteria, fungi, and protozoa populations are living inside the gut of wildlife and domesticated birds and some of them may be spread into new hosts in human or other animal species at least as transient microflora [3]. The presence of these bacteria in other hosts can lead to the incidence of some infectious diseases, immune reactions with malfunction disorders, and antibiotic resistance in new hosts [4-6]. In recent decades, our relationship with birds has been increasing. More than poultry and other bird breeding farms all around the world, those were the origins of some significant viral diseases such as influenza; we kept and breed some birds as a game or ornamental birds. People trade the birds and birds are transferred from one country to another, with all contents in their bodies [7]. These birds can transfer some bacteria to their owners and other humans. Identification of possible microorganisms particularly potential opportunistic bacteria existing in birds' gut microflora can change our point of view about the origin of some emerging pathogenic bacteria. So, the present study was conducted to investigate the some bacteria in cage using universal PCR primers and analysis of partial 16SrRNA sequence.Material and Method
Research and Publication Ethics: The research was done in accordance to the ethical principles and the national norms and standards for conducting Medical Research in Iran and received the approval ID from Research Ethics Commitees of Amol University of Special Modern Technlogies: IR.AUSMT.REC.1401.001.Sample Collection: A total of 68 cloacal swabs were carefully collected from apparently healthy caged birds including pigeon (Columba livia) (n=44), chicken (Gallus gallus) (n=10), lovebird (Agapornis roseicollis) (n=8), and canary (Serinus canaria) (n=6) in Mazandaran province in Iran. Immediately after collection, each sample was inoculated into the sterile nutrient broth (NB) and kept in the ice box, and transported to the Bacteriology Laboratory of the Faculty of Veterinary Medicine, Amol University of Special Modern Technologies.
DNA Extraction: Genomic DNA from cloacal samples was isolated using a stool DNA extraction kit (Bioneer, Daejeon, South Korea) according to the producer endorsements with some adjustments. Concisely, 100 mg of each sample was mixed with 20 μL proteinase K and 100 μL lysis buffer and incubated for 10 min at 55 °C. After centrifugation of the mixture at 13000 rpm, the supernatant was mixed with 200 μL binding solution in a new tube and incubated again for 10 min at 60 °C. After incubation, 100 μL isopropanol was added to the tube and then the liquid was transferred into the binding column and centrifuged for 1 min at 8000 rpm. This step was repeated using 500 μl for both washing buffers 1 and 2; then, DNA was precipitated using 100 μL elution buffer and centrifugation at 13000 rpm for 1 min. Extracted DNA was kept at -20 °C until using in PCR.
PCR Assay: Two universal oligonucleotide primers including forward primer with the sequence of `5- CGGTGGGTACTAGGTGTGGGTTTC -3` and reverse primer with the sequence of `5- CTGCGATTACTAGCGACTCCGACTTCA -3` previously described for Mycobacterium species were used to amplify the partial 16S rRNA locus [8]. The PCR reaction mixtures consisted of 100 ng DNA template, 2.5 μl 10x PCR buffer (75 mM Tris-HCl, pH 9.0, 2 mM MgCl2, 50 mM KCl, 20 mM (NH4)2SO4; Bioneer, Daejeon, South Korea), 0.2 mM dNTPs (Bioneer, Daejeon, South Korea), 1.5 U AmpliTaq DNA polymerase (Bioneer, Daejeon, South Korea), and 10 pmol each primer (Takapouzist, Tehran, Iran). The volume of the reaction mixture was completed to 25 μl using distilled deionized water. The thermal cycler (MJ mini, BioRad, USA) was adjusted under optimum conditions. Briefly, Initial denaturation at 94°C for 4 min, followed by 33 cycles of denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 1 min. The final extension was carried out at 72°C for 7 min. Amplified products, with 543 bp length, were separated by electrophoresis in 1.5% agarose gel electrophoresis stained with ethidium bromide (Cinacolon, Tehran, Iran). The 100 bp DNA ladder was used as a molecular size marker.
Sequencing and Phylogenetic Analysis: PCR products of the positive samples with the specific suspected bands for primers were subjected to sequencing (Takapuzist Co., Iran). The sequencing results were submitted, analyzed, and compared to the GenBank databases using the BLAST program maintained by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). In addition, multiple sequence alignments were made by the ClustalW method, using MEGA7 software and the phylogenetic tree was drawn using the Bootstrap method with 1000 replications [9].
Results
Out of 68 cloacal samples, 11 (16.1%) were positive for PCR reaction and produced a 543bp PCR fragment (Figure 1). PCR products of all 11 positive samples were subjected to sequencing and take the sequence accession numbers from NCBI respectively as follows: MG230316, MG203874, MG207961, MG208852, MG208062, and MG205784 for Colombia livia samples; MG206064, MG203881, and MG198762 for Gallus gallus samples; MG241109 for Agapornis rosicollis sample and MG206063 for Serinus canaria sample (Table 1).


Sequence analysis using NCBI BLAST and comparison with GeneBank sequences by MEGA software revealed a phylogenetic tree (Figure 2). Comparison of the sequences with other similar sequences showed the similarity of the seven sequences to Corynebacterium ulcerans, Corynebacterium pseudotuberclosis, Corynebacterium diphteriae, Corynebacterium rouxi, and Corynebacterium vitaruminins. One sequence showed high similarity to Tessaracoccus sp. Two sequences showed similarity to Christensenella species (Figure 2).

Discussion
The gastrointestinal microbiota reveals not only the evolution of the mutualism life of microorganisms with their host but also reflects the relationship with foods and other possible hosts around it. Providing proper bacteria as microflora in the gastrointestinal tract of animals can be a significant approach to yielding more healthy life for both humans and animals [3,10]. Identification of these bacteria is commonly performed using 16S rRNA sequencing [11,12]. In the present study in opposition to other studies, we did not use routine 16S rRNA-specific primers which amplify the whole 1525 bp sequence of the DNA. Primers used in the present study are previously designed for the partial conservation sequence of the Mycobacterium genus and related organisms. So identification of the complete microbiota in accordance with other studies which cloned the 16S rRNA sequence into the vector plasmids [13,14] was not done in the study.Analysis of the sequences obtained from PCR products showed great similarity to some pathogenic, human-microbiota-related organisms or emerging bacteria. Particularly, similarity to Corynebacterium species was found in seven positive samples. As we know Corynebacterium diphtheriae is the cause of classical diphtheria, and C. ulcerans has been found to convey the gene that codes for producing the diphtheria toxin that can cause swelling of the pharynx in humans [15]. Surprisingly in the present study sequences close to Corynebacterium species were associated with pigeon (Columba livia) samples.
The previous study showed that Christensenella minuta in the human gut has been associated with a decrease in body weight and adiposity of mice in the lab [16]. In an assessment of a number of volunteers, people with higher levels of Christensenella in their guts were found to be more likely to have a lower body mass index (BMI) than those with low levels and the bacterium is better characterized in persons who are metabolically healthy [17,18]. However, there is an association with the potential pathogenic abilities of C. minuta in humans [19]. In the present study sequences belonging to chicken (Gallus gallus) were related to Christensenella species. This issue can indicate the possibility of the presence of this opportunistic pathogen in breeding and native birds of each region.
Tessaracoccus is a Gram-positive, non-spore-forming, facultatively anaerobic, and non-motile bacterial genus from the family Propionibacteriaceae [20]. One of the sequences obtained from the chicken sample was greatly similar to Tessaracoccus flavescens. Other species of this genus have recently been detected from other sources such as dark diving beetle (Hydrophilus acuminatus), human vaginal swabs, and the Antarctic environment [21-23]. Definitely, in the present study, the exact determination of the species can be done after the isolation of bacterial isolates from these sources and with further studies.
Finally, the results of this study show that in addition to bacteria and other microorganisms present in the digestive system of birds under the title of microbiota, other bacteria as transient flora or accidental microorganisms can enter their digestive system as a potential reservoir to disperse and find a new host and environment.
Acknowledgment
This study was supported by Faculty of Veterinary Medicine, Amol University of Special Modern Technologies, Amol, Iran.
References
- McFall-Ngai M, Hadfield MG, Bosch TC, et al. Animals in a bacterial world, a new imperative for the life sciences. Proceed National Academy Sci 2013; 110(9): 3229-3236.
- Al-Marzooqi W, Al-Maskari ZA, Al-Kharousi K, et al. Diversity of intestinal bacterial microbiota of indigenous and commercial strains of chickens using 16S rDNA-based analysis. Animals 2020; 10(3): 391.
- Waite DW, Taylor MW. Characterizing the avian gut microbiota: membership, driving influences, and potential function. Front Microbiol 2014; 5: 223.
- Tsiodras S, Kelesidis T, Kelesidis I, et al. Human infections associated with wild birds. J Infect 2008; 56(2): 83-98.
- Vittecoq M, Godreuil S, Prugnolle F, et al. Antimicrobial resistance in wildlife. J Appl Ecol 2016; 53(2): 519-529.
- Sood U, Gupta V, Kumar R, et al. Chicken gut microbiome and human health: Past scenarios, current perspectives, and futuristic applications. Indian J Microbiol 2020; 60(1): 2-11.
- Ribeiro J, Reino L, Schindler S, et al. Trends in legal and illegal trade of wild birds: A global assessment based on expert knowledge. Biodivers Conserv 2019; 28(12): 3343-3369.
- Wilton S, Cousins D. Detection and identification of multiple mycobacterial pathogens by DNA amplification in a single tube. PCR Methods Appl 1992; 1: 269-273.
- Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016; 33(7): 1870-1874.
- Garcia-Mazcorro JF, Alanis-Lopez C, Marroquin-Cardona AG, et al. Composition and potential function of fecal bacterial microbiota from six bird species. Birds 2021; 2(1): 42-59.
- Garcia-Mazcorro JF, Castillo-Carranza SA, Guard B, et al. Comprehensive molecular characterization of bacterial communities in feces of pet birds using 16S marker sequencing. Microbial Ecol 2017; 73(1): 224-235.
- Tong L, Wang W, Ren S, et al. The 16S rRNA gene sequencing of gut microbiota in chickens ınfected with different virulent newcastle disease virus strains. Animals 2022; 12(19): 2558.
- Xenoulis PG, Gray PL, Brightsmith D, et al. Molecular characterization of the cloacal microbiota of wild and captive parrots. Vet Microbiol 2010; 146(3-4): 320-325.
- Darwish N, Shao J, Schreier LL, et al. Choice of 16S ribosomal RNA primers affects the microbiome analysis in chicken ceca. Sci Rep 2021; 11(1): 1-15.
- Sing A, Bierschenk S, Heesemann J. Classical diphtheria caused by Corynebacterium ulcerans in Germany: Amino acid sequence differences between diphtheria toxins from Corynebacterium diphtheriae and C. ulcerans. Clin Infect Dis 2005; 40(2): 325-326.
- Mazier W, Le Corf K, Martinez C, et al. A new strain of Christensenella minuta as a potential biotherapy for obesity and associated metabolic diseases. Cells 021; 10(4): 823.
- Goodrich JK, Waters JL, Poole AC, et al. Human genetics shape the gut microbiome. Cell 2014; 159(4): 789-799.
- Stenman LK, Burcelin R, Lahtinen S. Establishing a causal link between gut microbes, body weight gain and glucose metabolism in humans–towards treatment with probiotics. Benef Microbes 2016; 7(1): 11-22.
- Alonso BL, von Sierakowski AI, Nieto JAS, et al. First report of human infection by Christensenella minuta, a gram-negative, strickly anaerobic rod that inhabits the human intestine. Anaerobe 2017; 44: 124-125.
- Lee DW, Lee SD. Tessaracoccus flavescens sp. nov., isolated from marine sediment. Int J Syst Evol Microbiol 2008; 58(4): 785-789.
- Hyun DW, Sung H, Kim PS, et al. Tessaracoccus coleopterorum sp. nov., isolated from the intestine of the dark diving beetle, Hydrophilus acuminatus. Int J Syst Evol Microbiol 2020; 71(1): 004588.
- Fall NS, Lo CI, Fournier PE, et al. Arcanobacterium ihumii sp. nov., Varibaculum vaginae sp. nov. and Tessaracoccus timonensis sp. nov., isolated from vaginal swabs from healthy Senegalese women. New Microbes New Infect 2019; 31: 100585.
- Zhou LY, Zhang JY, Chen XY, et al. Tessaracoccus antarcticus sp. nov., a rhodopsin-containing bacterium from an Antarctic environment and emended description of the genus Tessaracoccus. Int J Syst Evol Microbiol 2020; 70(3): 1555-1561.
- Salmonella Isolation in Fish Obtained From Various Water Sources in Elazığ and Its Vicinity, and PCR Confirmation
- ELAZIĞ VE ÇEVRESİNDEKİ ÇEŞİTLİ SU KAYNAKLARINDAN TEMİN EDİLEN BALIKLARDAN SALMONELLA İZOLASYONU VE PCR İLE TEYİT EDİLMESİ
- The Mucosal Disease Cases Observed in Our Clinic and Confirmed with Reverse Transcription – Polymerase Chain Reaction (RT-PCR)
- KLİNİĞİMİZDE GÖZLEMLENEN REVERSE TRANSKRİPTAZ – POLİMERAZ ZİNCİR REAKSİYONU (RT-PCR) İLE DOĞRULANAN MUKOZA HASTALIĞI OLGULARI
- Random Amplified Polymorphic DNA (RAPD) Analysis of Escherichia Coli Isolated From Chickens